96
|
New England Biolabs
illumina compatible index sequence Illumina Compatible Index Sequence, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/illumina compatible index sequence/product/New England Biolabs Average 96 stars, based on 1 article reviews
illumina compatible index sequence - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
86
|
Danaher Inc
artic ncov 2019 v3 panel primers Artic Ncov 2019 V3 Panel Primers, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/artic ncov 2019 v3 panel primers/product/Danaher Inc Average 86 stars, based on 1 article reviews
artic ncov 2019 v3 panel primers - by Bioz Stars,
2026-04
86/100 stars
|
Buy from Supplier |
90
|
Thermo Fisher
multiplex pcr primer panel Multiplex Pcr Primer Panel, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multiplex pcr primer panel/product/Thermo Fisher Average 90 stars, based on 1 article reviews
multiplex pcr primer panel - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
94
|
New England Biolabs
index primers Index Primers, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/index primers/product/New England Biolabs Average 94 stars, based on 1 article reviews
index primers - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
multiplexing pcr primer 1.0 5’aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct Multiplexing Pcr Primer 1.0 5’aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multiplexing pcr primer 1.0 5’aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct/product/Illumina Inc Average 90 stars, based on 1 article reviews
multiplexing pcr primer 1.0 5’aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Thermo Fisher
prism snapshot multiplex kits Prism Snapshot Multiplex Kits, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prism snapshot multiplex kits/product/Thermo Fisher Average 90 stars, based on 1 article reviews
prism snapshot multiplex kits - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
97
|
New England Biolabs
index primer Index Primer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/index primer/product/New England Biolabs Average 97 stars, based on 1 article reviews
index primer - by Bioz Stars,
2026-04
97/100 stars
|
Buy from Supplier |
90
|
Seegene Technologies
dual priming oligonucleotide Dual Priming Oligonucleotide, supplied by Seegene Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dual priming oligonucleotide/product/Seegene Technologies Average 90 stars, based on 1 article reviews
dual priming oligonucleotide - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
94
|
fluidigm
multiplex amplicon panel Multiplex Amplicon Panel, supplied by fluidigm, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multiplex amplicon panel/product/fluidigm Average 94 stars, based on 1 article reviews
multiplex amplicon panel - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
90
|
Oligos Etc
indexed reverse primers Indexed Reverse Primers, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/indexed reverse primers/product/Oligos Etc Average 90 stars, based on 1 article reviews
indexed reverse primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
amplicon sequencing Amplicon Sequencing, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/amplicon sequencing/product/Illumina Inc Average 90 stars, based on 1 article reviews
amplicon sequencing - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Thermo Fisher
multiplex polymerase chain reaction primer panel Multiplex Polymerase Chain Reaction Primer Panel, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multiplex polymerase chain reaction primer panel/product/Thermo Fisher Average 90 stars, based on 1 article reviews
multiplex polymerase chain reaction primer panel - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |