multiplex primer design software visual omp Search Results


96
New England Biolabs illumina compatible index sequence
Illumina Compatible Index Sequence, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/illumina compatible index sequence/product/New England Biolabs
Average 96 stars, based on 1 article reviews
illumina compatible index sequence - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

86
Danaher Inc artic ncov 2019 v3 panel primers
Artic Ncov 2019 V3 Panel Primers, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/artic ncov 2019 v3 panel primers/product/Danaher Inc
Average 86 stars, based on 1 article reviews
artic ncov 2019 v3 panel primers - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

90
Thermo Fisher multiplex pcr primer panel
Multiplex Pcr Primer Panel, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiplex pcr primer panel/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
multiplex pcr primer panel - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

94
New England Biolabs index primers
Index Primers, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/index primers/product/New England Biolabs
Average 94 stars, based on 1 article reviews
index primers - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

90
Illumina Inc multiplexing pcr primer 1.0 5’aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct
Multiplexing Pcr Primer 1.0 5’aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiplexing pcr primer 1.0 5’aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct/product/Illumina Inc
Average 90 stars, based on 1 article reviews
multiplexing pcr primer 1.0 5’aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Thermo Fisher prism snapshot multiplex kits
Prism Snapshot Multiplex Kits, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prism snapshot multiplex kits/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
prism snapshot multiplex kits - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

97
New England Biolabs index primer
Index Primer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/index primer/product/New England Biolabs
Average 97 stars, based on 1 article reviews
index primer - by Bioz Stars, 2026-04
97/100 stars
  Buy from Supplier

90
Seegene Technologies dual priming oligonucleotide
Dual Priming Oligonucleotide, supplied by Seegene Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dual priming oligonucleotide/product/Seegene Technologies
Average 90 stars, based on 1 article reviews
dual priming oligonucleotide - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

94
fluidigm multiplex amplicon panel
Multiplex Amplicon Panel, supplied by fluidigm, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiplex amplicon panel/product/fluidigm
Average 94 stars, based on 1 article reviews
multiplex amplicon panel - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

90
Oligos Etc indexed reverse primers
Indexed Reverse Primers, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/indexed reverse primers/product/Oligos Etc
Average 90 stars, based on 1 article reviews
indexed reverse primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Illumina Inc amplicon sequencing
Amplicon Sequencing, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/amplicon sequencing/product/Illumina Inc
Average 90 stars, based on 1 article reviews
amplicon sequencing - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Thermo Fisher multiplex polymerase chain reaction primer panel
Multiplex Polymerase Chain Reaction Primer Panel, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiplex polymerase chain reaction primer panel/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
multiplex polymerase chain reaction primer panel - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results